View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_182 (Length: 246)
Name: NF11745_low_182
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_182 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 21 - 194
Target Start/End: Complemental strand, 5870656 - 5870482
Alignment:
| Q |
21 |
taaatataaccgggtcaaaaattgtttcattcaaaagttgaaatcgaattcttacaaatga---attattttgtaaacttattaaccatttaggcttaat |
117 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5870656 |
taaatataaccggatcaaaa-ttgtttcattcaaaagttgaaatcgaattcttacaaatgattcattattttgtaaacttattaaccatttaggcttaat |
5870558 |
T |
|
| Q |
118 |
tattttgnnnnnnnaccgacatttagtatcaacttagtaataaataactatgctagcaaaaagtagtataacacact |
194 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5870557 |
tattttg-ttttttaccgacatttagtatcaacttagtaataaataactatgctagcaaaaagtagtataacgcact |
5870482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University