View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_189 (Length: 243)
Name: NF11745_low_189
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_189 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 16 - 111
Target Start/End: Original strand, 17519913 - 17520008
Alignment:
| Q |
16 |
gagcagagatctagtgcaggaatccctggaacgagaaaaatggttgaaagctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa |
111 |
Q |
| |
|
||||||| ||| || | |||||||| | |||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17519913 |
gagcagaaatccagaggaggaatccatcgaactagaaaaatgattgaaggctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa |
17520008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 14814233 - 14814172
Alignment:
| Q |
50 |
gaaaaatggttgaaagctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa |
111 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14814233 |
gaaaattggttgaaggctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa |
14814172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 15261228 - 15261167
Alignment:
| Q |
50 |
gaaaaatggttgaaagctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa |
111 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15261228 |
gaaaattggttgaaggctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa |
15261167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University