View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11745_low_189 (Length: 243)

Name: NF11745_low_189
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11745_low_189
NF11745_low_189
[»] chr5 (1 HSPs)
chr5 (16-111)||(17519913-17520008)
[»] chr7 (2 HSPs)
chr7 (50-111)||(14814172-14814233)
chr7 (50-111)||(15261167-15261228)


Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 16 - 111
Target Start/End: Original strand, 17519913 - 17520008
Alignment:
16 gagcagagatctagtgcaggaatccctggaacgagaaaaatggttgaaagctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa 111  Q
    ||||||| ||| || | |||||||| | |||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||    
17519913 gagcagaaatccagaggaggaatccatcgaactagaaaaatgattgaaggctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa 17520008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 14814233 - 14814172
Alignment:
50 gaaaaatggttgaaagctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa 111  Q
    ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
14814233 gaaaattggttgaaggctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa 14814172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 15261228 - 15261167
Alignment:
50 gaaaaatggttgaaagctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa 111  Q
    ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
15261228 gaaaattggttgaaggctacatggaagtttctggagcatggaatcagtgaaatcttgaacaa 15261167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University