View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_190 (Length: 243)
Name: NF11745_low_190
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_190 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 9692292 - 9692070
Alignment:
| Q |
1 |
tgtatacattggtctacctgaatacaatcaccctttttatattttcattgtttgaataacttgttatttatgctttttatgtatatggatgttcatgata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692292 |
tgtatacattggtctacctgaatacaatcactctttatatattttcattgtttgaataacttgttatttatgctttttatgtatatggatgttcatgata |
9692193 |
T |
 |
| Q |
101 |
tgatccaatttcaattgattgcaaaccccgacttttacaatttgccctagttatttttcctttatgtctttattgattatgtccattgactaaacaattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9692192 |
tgatccaatttcaattgattgcaaaccccgacttttacaatttgccctagttatttttcctttatgtctttattgattatgtctattgactaaacaattt |
9692093 |
T |
 |
| Q |
201 |
cctataagccgcgccatacacatcg |
225 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
9692092 |
cctataagc--cgccatacacatcg |
9692070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University