View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_194 (Length: 241)
Name: NF11745_low_194
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_194 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 41154106 - 41153883
Alignment:
| Q |
18 |
attgttggacaaattaacaatagatagattactccaaacagaaaaatccaatggtaatggtcccgaaaacttgttagattgaagataaagactagtcaag |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41154106 |
attgttggaaaaattaacaatagatagattactccaaacagaaaaatccaatggtaatggtccggaaaacttgttagattgaagataaagactagtcaag |
41154007 |
T |
 |
| Q |
118 |
tttttcagctcagagaaaccatcagggaaatcaccagtgataccatttgatctaagactaacagtctcgagagccgaaagacgattgagagtgtttggtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41154006 |
tttttcagctcagagaaaccatcagggaaatcaccagtgataccatttgatctaagactaacagtctcgagagccgaaagacgattgagagtgtttggtg |
41153907 |
T |
 |
| Q |
218 |
ggattggaccgcttaacccggctc |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41153906 |
ggattggaccgcttaacccggctc |
41153883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University