View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_196 (Length: 241)
Name: NF11745_low_196
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_196 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 742565 - 742793
Alignment:
| Q |
1 |
atcaattatcgttgattatggatatcaaatttatgtgataagcaattgtccgtacctcnnnnnnnnnnnnncatttgtccataatatatgatttttaaat |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
742565 |
atcaattatcgttgtgtatggatatcaaatttatgtgataagcaattgtccgtacctcaaaaaagaaaaaacatttgtccataatatatgatttttaaac |
742664 |
T |
 |
| Q |
101 |
attagagcattcataagttagctatttgggagattgatttgtccgttaacttagttaagttggtacgaacattgtattatatatgcatggaccagaggtt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
742665 |
attagagcattcataatttagctatttgagagattgatttgtccgttaacttagttaagttggtatgaacattgcattatatatgcatggaccagaggtt |
742764 |
T |
 |
| Q |
201 |
caaataccagatttcccacttattcatct |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
742765 |
caaataccagatttcccacttattcatct |
742793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University