View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_208 (Length: 239)
Name: NF11745_low_208
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_208 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 42799424 - 42799641
Alignment:
| Q |
1 |
cgtggatcattgaaatgtaacagtcatgcagctatgttcgtgattcaaaatagcttttggggtatgattgggttctataacttgtgcaatgttttgctat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42799424 |
cgtggatcattgaaatgtaacagtcatgcagctatgttcgtgattcaaaatagctttgggggtaggattgggttctataacttgtgcaatgttttgttat |
42799523 |
T |
 |
| Q |
101 |
tgttgtatcattaatcgtttctctctaaatattatacttctgaaacccataggtggttaatgctagtttcaaaactaaccttgggaggtacgtaactaag |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799524 |
tcctgtatcattaatcgtttctctctaaatattata------aaacccataggtggttaatgctagtttcaaaactaaccttgggaggtacgtaactaag |
42799617 |
T |
 |
| Q |
201 |
aaagttatacaatgacttgaatat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42799618 |
aaagttatacaatgacttgaatat |
42799641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University