View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_209 (Length: 239)
Name: NF11745_low_209
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_209 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 44527871 - 44528081
Alignment:
| Q |
13 |
attggatcatttgtttgacttttacaaatcatatggagacacatttcagaaaggagtctcctggttgtattcaagtgatttggctagcttgtatcttgat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44527871 |
attggatcatttgtttgacttttacaaatcatatggagacacattt-agaaaggagtctccttgttgtattcaagtgatttggctagcttgtatcttgat |
44527969 |
T |
 |
| Q |
113 |
catttgaaaagagcgcaattcaaaacaattatcaacaacacaattttatttggatcgattacttgagcagatcaaactttatttgtggtgatgattgaag |
212 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44527970 |
catttgaaaatagcgcaattcaaaaaaattatcaacaacacagttttatttggatcaattacttgagcagatcaaactttatttgtggtgatgattgaag |
44528069 |
T |
 |
| Q |
213 |
actttcaaacct |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44528070 |
actttcaaacct |
44528081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University