View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_212 (Length: 238)
Name: NF11745_low_212
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_212 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 174
Target Start/End: Original strand, 47362552 - 47362706
Alignment:
| Q |
20 |
cgtactgattctactgaattggccaagcttgaaagagattttaccggtgctgcagcaccggcttctgcggcttttcctcttcatgtagctaggtttgcat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47362552 |
cgtactgattctactgaattggccaagcttgaaagagattttaccggtgctgcagcaccggcttctgcggcttttcctcttcatgtagctaggtttgcat |
47362651 |
T |
|
| Q |
120 |
tctctcagctttggaggcacattttgtttgttacgtttccgagggagttggttgt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47362652 |
tctctcagctttggaggcacattttgtttgttacgtttccgagggagttggttgt |
47362706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University