View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_216 (Length: 237)
Name: NF11745_low_216
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_216 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 36908326 - 36908459
Alignment:
| Q |
1 |
tactcctaagaaaatgaatccctcaagtgaaggcttagttttag-caacatgcaattagtatgaacctcaattgaaattgaaccattcattttgcacaat |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36908326 |
tactcctaagaaaatgaacccctcaagtgaaggcttgggtttaggcaacatgcaattagtatgaacctcaattgaaattgaaccattcattttgcacaat |
36908425 |
T |
|
| Q |
100 |
ctttgtcttgcatgagttatagagtatttggcat |
133 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |
|
|
| T |
36908426 |
ctctgtcttgcatgagttatagagtatttggcat |
36908459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 36903902 - 36904017
Alignment:
| Q |
107 |
ttgcatgagttatagagtatttggcatcacatcacatacataccaagtaaacaaatgtgccatcagaaactttgtaaaagcaagatgaaatcagtttata |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
36903902 |
ttgcatgagttatagagtatttggcatcacatcacatacataccaagtaaacaaatgggccatcagaaactttgtgaaagcaagatgaaat-agtttata |
36904000 |
T |
|
| Q |
207 |
caaacccatgataaaag |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36904001 |
caaacccatgataaaag |
36904017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 36903830 - 36903878
Alignment:
| Q |
1 |
tactcctaagaaaatgaatccctcaagtgaaggcttagttttagcaaca |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36903830 |
tactcctaagaaaatgaatccctcaagtgaaggcttagttttagcaaca |
36903878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 36908462 - 36908498
Alignment:
| Q |
187 |
caagatgaaatcagtttatacaaacccatgataaaag |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36908462 |
caagaggaaatcagtttatacaaacccatgataaaag |
36908498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University