View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_218 (Length: 235)
Name: NF11745_low_218
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_218 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 8839848 - 8840053
Alignment:
| Q |
11 |
agagaagaaggaaggaaatgcagaaaccattgaggctgtgaagtctcctcctatctgtgagaaggtttcagaagacattgatcattttcttcttcatgag |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8839848 |
agagaacaaggaaggaaatgcagaaaccattgaggctgtgaagtctccccctatctgtgagaaggtttcagaagacattgatcattttcttctgcatgag |
8839947 |
T |
|
| Q |
111 |
aaagaaggagtgtcgtttgagattcctggttacatagagaagtttttggatcaggtggaggagaatatggtgaagaatgaaactggagaacggaaaggaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8839948 |
aaagaaggagtgtcgtttgagattcctggttacatagagaagtttttggatcaggtggaggagaatatggtgaagaatgaaactggagaacggaaaggaa |
8840047 |
T |
|
| Q |
211 |
aatggg |
216 |
Q |
| |
|
|||||| |
|
|
| T |
8840048 |
aatggg |
8840053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 101
Target Start/End: Complemental strand, 10627094 - 10627062
Alignment:
| Q |
69 |
gagaaggtttcagaagacattgatcattttctt |
101 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
10627094 |
gagaaggtttcagaagacattgatcaatttctt |
10627062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University