View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_220 (Length: 233)
Name: NF11745_low_220
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_220 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 16 - 156
Target Start/End: Complemental strand, 33781361 - 33781221
Alignment:
| Q |
16 |
taggggattacaaagaagggtattatattggagttgaagtagatgaagatgacccagaatcaaataaacccttttatgggcctaataaatggcctgcacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33781361 |
taggggattacaaagaagggtattatattggagttgaagtagatgaagatgacccagaatcaaataaacccttttatgggcctaataaatggcctgcacc |
33781262 |
T |
 |
| Q |
116 |
aggtaaagagttaaaaaacttacctttagaggaaaaatatg |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33781261 |
aggtaaagagttaaaaaacttacctttagaggaaaaatatg |
33781221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University