View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_223 (Length: 231)
Name: NF11745_low_223
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_223 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 14 - 169
Target Start/End: Complemental strand, 39934853 - 39934698
Alignment:
| Q |
14 |
agatgaaagacatgtttataaaggagggcttaattctccaagtgattgaaaccgatagggatcttgctttcatgatagtcattgaaattgtatttccaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
39934853 |
agatgaaagacatgtttataaaggagggcttaattctccaagtgattgaaaccgatagggatcttgctttgatgatagccattgaaattgtatttccaga |
39934754 |
T |
 |
| Q |
114 |
tactgttaatttgctttgttcgtttcacataaacaaaaatgttggtgcaacttgac |
169 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39934753 |
tcctgttaatttgctttgttcgtttcacataaacaaaaatgttggtgcaacttgac |
39934698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University