View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11745_low_224 (Length: 231)

Name: NF11745_low_224
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11745_low_224
NF11745_low_224
[»] chr1 (2 HSPs)
chr1 (18-209)||(44668354-44668545)
chr1 (46-209)||(44640041-44640204)


Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 44668545 - 44668354
Alignment:
18 cataattaatgcatgttacctaaaaaggaaacttcgcgatgctggcatttgcacaatgttgaatgaatatagcaatacagttgtttttgagaagccttta 117  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44668545 cataatgaatgcatgttacctaaaaaggaaacttcgcgatgctggcatttgcacaatgttgaatgaatatagcaatacagttgtttttgagaagccttta 44668446  T
118 gattgtgagtttattcgaaaatggaatttagcttatgaaggagatattgcacatgtggtggtgatgcagcacgtaactgttgaaatgttgga 209  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
44668445 gattgtgagtttattcgaaaatggaatctagcttatgaaggagatattgcacatgtggtggtgatgcagcacgttactgttgaaatgttgga 44668354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 46 - 209
Target Start/End: Complemental strand, 44640204 - 44640041
Alignment:
46 aaacttcgcgatgctggcatttgcacaatgttgaatgaatatagcaatacagttgtttttgagaagcctttagattgtgagtttattcgaaaatggaatt 145  Q
    |||||||| |||||||| ||| | |||||||| ||||||| |||||| ||||||||||||||||||||||| |||  ||||||||||||||| |||| ||    
44640204 aaacttcgtgatgctggaattggtacaatgttaaatgaatttagcaacacagttgtttttgagaagcctttggatattgagtttattcgaaagtggagtt 44640105  T
146 tagcttatgaaggagatattgcacatgtggtggtgatgcagcacgtaactgttgaaatgttgga 209  Q
    |||| ||| ||||| ||||||||||||||||||||||||| || || ||| |||||||||||||    
44640104 tagcatatcaaggaaatattgcacatgtggtggtgatgcaacatgttactattgaaatgttgga 44640041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University