View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_228 (Length: 229)
Name: NF11745_low_228
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_228 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 33 - 224
Target Start/End: Complemental strand, 31869703 - 31869512
Alignment:
| Q |
33 |
ttattcatgagatgtaacattcaagattttcactatgttcttggtccctacctcttctaataatgcaccaagcaatatatatatttctcaacaaggttaa |
132 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869703 |
ttattcatgagatgtaatattcaagattttcactatgttcttggtccctacctcttctaataatgcaccaagcaatatatatatttctcaacaaggttaa |
31869604 |
T |
 |
| Q |
133 |
ggatactatttaacatgctgtttttgtgttttccttttgccaaagaaagattagatgaaatagcaaaaataaactcagagggagaaacttct |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869603 |
ggatactatttaacatgctgtttttgtgttttctttttgccaaagaaagattagatgaaatagcaaaaataaactcagagggagaaacttct |
31869512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University