View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_232 (Length: 227)
Name: NF11745_low_232
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_232 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 55968426 - 55968542
Alignment:
| Q |
1 |
ccctgttctatgagaaaccatcatgttgctatctgcatctaatacatttataattgaacaataaaagtacatcatttaacatactaacgtagtcgttgct |
100 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55968426 |
ccctgctctatgagaaactatcatgttgctatctgcatctaatacatttataattgaacaataaaagtacatcatttaacatactaacgtagtcgttgct |
55968525 |
T |
 |
| Q |
101 |
tgttctatgacttaata |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
55968526 |
tgttctatgacttaata |
55968542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 55984510 - 55984394
Alignment:
| Q |
1 |
ccctgttctatgagaaaccatcatgttgctatctgcatctaatacatttataattgaacaataaaagtacatcatttaacatactaacgtagtcgttgct |
100 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55984510 |
ccctgctctatgagaaactatcatgttgctatctgcatctaatacatttataattgaacaataaaagtacatcatttaacatactaacgtagtcgttgct |
55984411 |
T |
 |
| Q |
101 |
tgttctatgacttaata |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
55984410 |
tgttctatgacttaata |
55984394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 116 - 210
Target Start/End: Original strand, 55968824 - 55968918
Alignment:
| Q |
116 |
tatatactattgcatgtatgtatgtatcatgtttctatacgcaatttatgattgtgcaatatttattatatcccatcgacccaacaagtctctgc |
210 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55968824 |
tatatattgttgcatgtatgcatgtatcatgtttctatacgcaatttatgattgtgcaatatttattatatcccatctacccaacaagtctctgc |
55968918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 116 - 210
Target Start/End: Complemental strand, 55984112 - 55984018
Alignment:
| Q |
116 |
tatatactattgcatgtatgtatgtatcatgtttctatacgcaatttatgattgtgcaatatttattatatcccatcgacccaacaagtctctgc |
210 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55984112 |
tatatattgttgcatgtatgcatgtatcatgtttctatacgcaatttatgattgtgcaatatttattatatcccatctacccaacaagtctctgc |
55984018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 185
Target Start/End: Original strand, 55968393 - 55968425
Alignment:
| Q |
153 |
tacgcaatttatgattgtgcaatatttattata |
185 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
55968393 |
tacgcagtttatgattgtgcaatatttattata |
55968425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 185
Target Start/End: Complemental strand, 55984543 - 55984511
Alignment:
| Q |
153 |
tacgcaatttatgattgtgcaatatttattata |
185 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
55984543 |
tacgcagtttatgattgtgcaatatttattata |
55984511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University