View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_244 (Length: 210)
Name: NF11745_low_244
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_244 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 28092177 - 28092004
Alignment:
| Q |
18 |
cttccacaaatacccttgtattttgcccttcattttatacaattttggttttnnnnnnngtaatcatgttatttgctnnnnnnntatatatgattgtatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| || |||||||||||||| | |
|
|
| T |
28092177 |
cttccacaaatacccttgtattttgcccttcattttatacaattttggttttaaaaaaagtaatcatattatttactaaaaaaatatatatgattgtacc |
28092078 |
T |
 |
| Q |
118 |
attgaacaccgaataaatgtctttgtgaattattcacatagagtatggttgaggaacctctataaattcgtatt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28092077 |
attgaacaccgaataaatgtctttgtgaattattcacatagagtatggttgaggaacctctataaattcgtatt |
28092004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University