View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_247 (Length: 207)
Name: NF11745_low_247
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_247 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 742357 - 742170
Alignment:
| Q |
1 |
tggcaatatataatagatacccatcaattcatatttcaatgaattagaagcaatgaaggagcccaacttagaaaagatttactgtttggctaacaaattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
742357 |
tggcaatatataatagatacccatcaattcatatttcaatgaa--------------ggagcccaacttagaaaagatttactgtttggctaacaaattg |
742272 |
T |
 |
| Q |
101 |
tgtttatcatttcaacaatagtcgttggacaaacgaaaaatatggaaaagcacaagcatttttcctccctattttttatgtgattatacgtgtatgtctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
742271 |
tgtttatcatttcaacaatagtcgttggacaaacgaaaaatatggaaaagcacaagcatttttcctccctattttttatgtgattatacgtgtatgtctg |
742172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 120
Target Start/End: Original strand, 3983224 - 3983272
Alignment:
| Q |
72 |
aaaagatttactgtttggctaacaaattgtgtttatcatttcaacaata |
120 |
Q |
| |
|
|||||||||| || ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
3983224 |
aaaagatttattgactggctaacaaattttgtgtatcatttcaacaata |
3983272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University