View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11745_low_250 (Length: 204)

Name: NF11745_low_250
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11745_low_250
NF11745_low_250
[»] chr5 (2 HSPs)
chr5 (15-182)||(37035705-37035872)
chr5 (15-81)||(21309502-21309568)


Alignment Details
Target: chr5 (Bit Score: 144; Significance: 6e-76; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 15 - 182
Target Start/End: Original strand, 37035705 - 37035872
Alignment:
15 caaaggaagagagcggacatgatcaatagtactagaagtatgcaggaaagagagaaggcagaattgggcaaatatcagcttttccggtctcagatgcggc 114  Q
    ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||    
37035705 caaaggaagagagcgaacataatcaatagtactagaagtatgcaggaaagagagaaggcagaattggacaaatagcagcttttccggtctcagatgcggc 37035804  T
115 aacacccattactagtgttagcatgttatcactttccctcttttctcgcatgaggcaagcaaggcctg 182  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||    
37035805 aacacccattactagtgttagcatgttatcactttctctcttttctcgcacgaggcaagcaaggcctg 37035872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 15 - 81
Target Start/End: Complemental strand, 21309568 - 21309502
Alignment:
15 caaaggaagagagcggacatgatcaatagtactagaagtatgcaggaaagagagaaggcagaattgg 81  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
21309568 caaaggaagagagcggacatgatcaatagtactagaagtatacaggaaagagagaaggcagaattgg 21309502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University