View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_250 (Length: 204)
Name: NF11745_low_250
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_250 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 6e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 15 - 182
Target Start/End: Original strand, 37035705 - 37035872
Alignment:
| Q |
15 |
caaaggaagagagcggacatgatcaatagtactagaagtatgcaggaaagagagaaggcagaattgggcaaatatcagcttttccggtctcagatgcggc |
114 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
37035705 |
caaaggaagagagcgaacataatcaatagtactagaagtatgcaggaaagagagaaggcagaattggacaaatagcagcttttccggtctcagatgcggc |
37035804 |
T |
|
| Q |
115 |
aacacccattactagtgttagcatgttatcactttccctcttttctcgcatgaggcaagcaaggcctg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
37035805 |
aacacccattactagtgttagcatgttatcactttctctcttttctcgcacgaggcaagcaaggcctg |
37035872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 15 - 81
Target Start/End: Complemental strand, 21309568 - 21309502
Alignment:
| Q |
15 |
caaaggaagagagcggacatgatcaatagtactagaagtatgcaggaaagagagaaggcagaattgg |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21309568 |
caaaggaagagagcggacatgatcaatagtactagaagtatacaggaaagagagaaggcagaattgg |
21309502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University