View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_54 (Length: 442)
Name: NF11745_low_54
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 98 - 294
Target Start/End: Original strand, 36864992 - 36865188
Alignment:
| Q |
98 |
ctgtactgcagtgaaaatacctaggttgacaccactcaagtacattttgaagtcctgaagatctttaaccacttggagaagttcgttgtagatggcaacg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36864992 |
ctgtactgcagtgaaaatacctaggttgacaccactcaagtacattttgaagtcctgaagatctttaaccacttggagaagttcgttgtagatggcaacg |
36865091 |
T |
|
| Q |
198 |
tcagaataaattatctcaaagttgtgactaaacaagacctttagtttttccaaatgctcaactaccttggaattacaagagtcttgactcttgagaa |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36865092 |
tcagaataaattatctcaaagttgtgactaaacaagacctttagtttttccaaatgctctactaccttggaattacaagagtcttgactcttgagaa |
36865188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 293 - 432
Target Start/End: Original strand, 36865221 - 36865364
Alignment:
| Q |
293 |
aatatcataatttgtaatttgatctcctttgggagaaaaatccaaatgtttctctatggttctctcttgagatg----catcaacattgagacgttcatc |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36865221 |
aatatcataatttgtaatttgatctcctttgggagaaaaatccaaatgtttctctatggttctctcttgagatgtatatatcaacattgagacgttcatc |
36865320 |
T |
|
| Q |
389 |
agcagtaatctccaaaataggttggatatacgtggcatcctttg |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36865321 |
agcagtaatctccaaaataggttggatatacgtggcatcctttg |
36865364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 64 - 92
Target Start/End: Original strand, 36864948 - 36864976
Alignment:
| Q |
64 |
ttggtgataaaagggatgtcaatacgaag |
92 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36864948 |
ttggtgataaaagggatgtcaatacgaag |
36864976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University