View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_73 (Length: 390)
Name: NF11745_low_73
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_73 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 1 - 375
Target Start/End: Original strand, 34306046 - 34306399
Alignment:
| Q |
1 |
tcttttgatttttgatgcctttggacattcacttgggtacattttgcttgcatgaagcataattgtgaacaaaaatgactgaaaatattacattttttgt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34306046 |
tcttttggtttttgatgcctttggacattcacttgggtacattttgcttgcatgaagcataattgtgaacaaaaatgactgaaaatattaca-tttttgt |
34306144 |
T |
|
| Q |
101 |
aattcttggcagtgtagtggtgctacaatttttggaacacaatgaccaccttcattcctttggaaactttcagcagagcccaaatgcatgtgtatgggaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306145 |
aattcttggcagtgtagtggtgctacaatttttggaacacaatgaccaccttcattcctttggaaactttcagcagagcccaaat--------------- |
34306229 |
T |
|
| Q |
201 |
aaatcgacttgtaaatatggtaattgtctaaggtatgctagctctattttgatcttatacgcaagttgggacttaggctttttcaatactcccaaaatgc |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306230 |
-----gacttataaatatggtaattgtctaaggtatgctagctctattttgatcttatatgcaagttgggacttaggctttttcaatactcccaaaatgc |
34306324 |
T |
|
| Q |
301 |
caaaagattatgaggggagattccagacctaatagaagcttcattaggagcaccaacgtttattctttgagcttc |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306325 |
caaaagattatgaggggagattccagacctaatagaagcttcattaggagcaccaacgtttattctttgagcttc |
34306399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University