View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_95 (Length: 356)
Name: NF11745_low_95
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_95 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 1 - 356
Target Start/End: Original strand, 32771788 - 32772143
Alignment:
| Q |
1 |
ctcagatatcactctcatcttccttaagcagaagattgaagagcaacggtagcatgaaaggtggtcaagcttcaccaatgtttccaacaggtggaaagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32771788 |
ctcagatatcactctcatcttccttaagcagaagattaaagagcaacggtagcatgaaaggtggtcaagcttcaccaatgtttccaacaggtggaaagaa |
32771887 |
T |
 |
| Q |
101 |
aagagggtgtggttttgagaatccagagccttcatcaccaaaagtaacttgcattggacaagttagagtgaagacaaagaaacaagggaagaaaatgagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32771888 |
aagagggtgtggttttgagaatccagagccttcatcacctaaagtaacttgcattggacaagttagagtgaagacaaagaaacaagggaagaaaatgagg |
32771987 |
T |
 |
| Q |
201 |
tcaaggtcaaagagaagaggtgaagctagttttagaagaggtggtggtgaaggaacaaatccagatctaactagacagaatagtcaaagtttgtatcaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32771988 |
tcaaggtcaaagagaagaggtgaagctagttttagaagaggtggtggtgaaggaacaaatccagatctaactagacagaatagtcaaagtttgtatcaaa |
32772087 |
T |
 |
| Q |
301 |
atcatcaaagtttgcaacaagagtgtttgaaacataggaatcaaagatgggttcat |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32772088 |
atcatcaaagtttgcaacaagagtgtttgaaacataggaatcaaagatgggttcat |
32772143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University