View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11745_low_99 (Length: 352)
Name: NF11745_low_99
Description: NF11745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11745_low_99 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 39 - 336
Target Start/End: Complemental strand, 47971086 - 47970790
Alignment:
| Q |
39 |
agaaattagtggtaaccgaacatttgagatagatttacttgagcttaaactcaaacacaagtttgtagatattnnnnnnngaactcttaatttccaatcg |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
47971086 |
agaaattagtggtaaccgaacatttgagatagatttactagagcttaaactcaaatacaagtttgtagatattaaaaaaagaactcttaatttccaatag |
47970987 |
T |
 |
| Q |
139 |
tctactctttacattttcatgttgcaatatgtcgaagcatctctttcaaagacgtataaccagatttgagtaatttagtaaggttttctaataaatnnnn |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47970986 |
tctactctttacattttcatgttgcaatatgtcgaagcatctctttcaaagacgtataatcagatttgagtaatttagtaaggttttctaataaa-aaaa |
47970888 |
T |
 |
| Q |
239 |
nnnttactaaggttttaagcttttaaaatataatttaacttactatcttatatttagcctttaacttttatgaaacttggcatttaccagcacttcat |
336 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47970887 |
aaattactcaggttttaagcttttaaaatagaatttaacttactatcttatatttagcctttaacttttatgaaacttggcatttaccagcacttcat |
47970790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University