View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_19 (Length: 392)
Name: NF11746_high_19
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 1 - 385
Target Start/End: Original strand, 30757299 - 30757683
Alignment:
| Q |
1 |
acttttgccgagtttttctgctataacagtataagcaacttgttcggcatttttaacttgagaatcattattaaaaaccttatctgcattaagaagtgtg |
100 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30757299 |
acttgtgccgagtttttatgctataacagtataagcaacttgttcggcatttttaacttgagaatcattattaacaaccttatctgcattaagaagtgtg |
30757398 |
T |
 |
| Q |
101 |
ggggttagaagtaacagggggttcagcatgacttgttggatgatcattagcaacaatgagctcttcggtattaatcagctcaccatgaagcttttcctga |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757399 |
ggggttagaagtaacagggggttcaacatgacttgttggatgatcattagtaacgatgagctcttcggtattaatcagctcaccatgaagcttttcctga |
30757498 |
T |
 |
| Q |
201 |
atatttgaagtgtcatcagtaccgaatgaaattgtggcagggatatgctcttcattcacaatggcaataaccgccttattagtaattggtgctgcaaaag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30757499 |
atatttgaagtgtcatcagtaccgaatgaaattgtggcagggatatgctcttcattcacaatggcaataaccgccttattagtaattggcgctgcaaaag |
30757598 |
T |
 |
| Q |
301 |
ctttagaagaacctataccatcaggatctttcttttcaacatatttcagagtcatttgcttccgagcatgtgtaggtttcttctc |
385 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30757599 |
ctttagaagaacctataccatcatgatcgttcttttcaacatatttcagagtcatttgcttccgagcatgtgtaggtttcttctc |
30757683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University