View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_29 (Length: 334)
Name: NF11746_high_29
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 63 - 320
Target Start/End: Original strand, 10774621 - 10774878
Alignment:
| Q |
63 |
acatcacatcttcacctaaaaaccttaagcatttgtgacctaattgatcaaaccacaccaaaattcatttggaaaggttctaacaacaccgacatcaacc |
162 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10774621 |
acatcacatcttcatctaaaaaccttaatcatttgtgacctaattgatcaaaccactccaaaattcatttggaaaggttctaacaacaccgacatcaacc |
10774720 |
T |
 |
| Q |
163 |
tggtgggttggcaaaatatagctaagcctaaggtttggtgaagactatgaattcctatagctcaagttatcaatatctctctccatgacaaatagtttgg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10774721 |
tggtgggttggcaaaatatagctaagcctaaggtttggtgaaaactatgaattcctatagctcaagatatcaatatctctctccatgacaaatagtttgg |
10774820 |
T |
 |
| Q |
263 |
gatatagttaaggtatctgacaaattgcaggttaatgttctatttaacaaatatgtct |
320 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10774821 |
gatatggttaaggtatctgacaaattgcaggttcatgttctatttaacaaatatgtct |
10774878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University