View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11746_high_31 (Length: 333)

Name: NF11746_high_31
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11746_high_31
NF11746_high_31
[»] chr6 (3 HSPs)
chr6 (238-325)||(15966402-15966489)
chr6 (1-33)||(15966554-15966586)
chr6 (212-240)||(15966514-15966542)


Alignment Details
Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 238 - 325
Target Start/End: Complemental strand, 15966489 - 15966402
Alignment:
238 tgaccatgaagtgtttatagtaaatgcattgcaatggtaacataccttaaatgcatttgtgaagtgtccctttttcaatcttcatctc 325  Q
    ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
15966489 tgaccatgaagtggttttagtaaatgcattgcaatggtaacataccttaaatgcatttgtgaagtggccctttttcaatcttcatctc 15966402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 15966586 - 15966554
Alignment:
1 ggacatggaatgatctcttcttgtgacgtacac 33  Q
    |||||||||||||||||||||||||||||||||    
15966586 ggacatggaatgatctcttcttgtgacgtacac 15966554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 212 - 240
Target Start/End: Complemental strand, 15966542 - 15966514
Alignment:
212 atttctacatgcctatccttgcagtgtga 240  Q
    |||||||||||||||||||||||||||||    
15966542 atttctacatgcctatccttgcagtgtga 15966514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University