View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_37 (Length: 303)
Name: NF11746_high_37
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 4611805 - 4612102
Alignment:
| Q |
1 |
caaaattgcgtgaaatgtgatagcatcaagttgcaacgaatccaacgataatgacactataagatatttacatatgttcctttcccttgtcttttatcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4611805 |
caaaattgcgtgaaatgtgatagcatcaagttgcaacgaatccaacgattatgacactataagatatttacatatgttcctttcccttgtcttttatcat |
4611904 |
T |
 |
| Q |
101 |
gctagtaaccaatatttataccctaaaatcagtaccaaagattctttgttatatacaatataaatttctaattcccaaaaagatttaagaatatttttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4611905 |
gctagtaaccaatatttataccctaaaatcagtaccaaagattctttgatatatacaatataaatttctaattcccaaaaagatttaagaatatttttca |
4612004 |
T |
 |
| Q |
201 |
-tttttataagtaacgatgtttttgc----------aaaaacatctttagggatttcataataaataacaaatacattatagtatcaattttactttt |
287 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4612005 |
ttttttataagtaacgatgtttttgcaaaaacatgtaaaaacatctttagggatttcataataaataacaaatacattatagtatcaattttactttt |
4612102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University