View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_38 (Length: 302)
Name: NF11746_high_38
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 7 - 288
Target Start/End: Complemental strand, 42665188 - 42664907
Alignment:
| Q |
7 |
gcatgaacgtctgcgttttacaattcctctaaggttccttaaccttaatatttttaagtgtctacttagagaatctgaggaggagtttggccttggtgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42665188 |
gcatgaacgtctgcgttttacaattcctctaaggttccttaaccttaatatttttaagtgtctacttagagaatctgaggaggagtttggccttggtgtt |
42665089 |
T |
 |
| Q |
107 |
aagggttgtttggttctcccttgtgaaataacttttttcagagaaattgtgaagcatgtcaagaaagatgagcataagtacggcaaattttctttggaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42665088 |
aagggttgtttggttctcccttgtgaaataacttttttcagagaaattgtgaagcatgtcaagaaagatgagcataagtacggcaaattttctttggagg |
42664989 |
T |
 |
| Q |
207 |
agtttgcaaacatgattttcaattcttatgaggaaaacaacaacattctcttcactcctctcttgcagaaagcaacatggtg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42664988 |
agtttgcaaacatgattttcaattcttacgaggaaaacaacaacattctcttcactcctctcttgcagaaagcaacatggtg |
42664907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University