View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_41 (Length: 279)
Name: NF11746_high_41
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 71 - 265
Target Start/End: Complemental strand, 35743346 - 35743149
Alignment:
| Q |
71 |
gtatactgcacattgaaatgtacatgcatgaagaaaaggaaagaaagcagccgacgttagaacaagaaaaaataattgttctgtgacagatggttggttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35743346 |
gtatactgcacattgaaatgtacatgcatgaagaaaaggaaagaaagcagccgacgtaagaacaagaaaaaataattgttctgtgacagatggttggttg |
35743247 |
T |
 |
| Q |
171 |
tattgtagcaatttgctctattcttttct---gcaaattttattagaaattttaccttcttttttgattggtttatgatatccacgttcatgaaggtg |
265 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35743246 |
tattgtagcaatttgctctattcttttttataagaaattttattagaaattttaccttcttttttgattggtttaggatatccacgttcatgaaggtg |
35743149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 4 - 62
Target Start/End: Complemental strand, 35743789 - 35743731
Alignment:
| Q |
4 |
tgagattggcccatgtgtgtaagaaagaaaggtccccagttgctaagatttatagcaac |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35743789 |
tgagattggcccatgtgtgtaagaaagaaaggtccccagttgctaagatttatagcaac |
35743731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University