View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_49 (Length: 256)
Name: NF11746_high_49
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 49336293 - 49336530
Alignment:
| Q |
1 |
atcttggaactgtatggtttcgggatatgctaaagcagggaaaatggatcgggcttgttatttgtttcaacaaatgccggagagaaattttgcctcttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49336293 |
atcttggaactgtatggtttcgggatatgctaaagcagggaaaatggatcgggcttgttatttgtttcaacaaatgccggagagaaattttgcctcttgg |
49336392 |
T |
 |
| Q |
101 |
aacacaatgattactggttatgttgactgtggaagcattgtggaagcaagagaattatttgatgcaatgccaaggagaaatagtgtctctttgataacta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49336393 |
aacacaatgattactggttatgttgactgtggaagcattgtggaagcaagagaattatttgatgcaatgccaaggagaaatagtgtctctttgataacta |
49336492 |
T |
 |
| Q |
201 |
tgattgccgggtattcgaagagtggggatgttgattct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49336493 |
tgattgccgggtattcgaagagtggggatgttcattct |
49336530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 125
Target Start/End: Complemental strand, 15066646 - 15066616
Alignment:
| Q |
95 |
tcttggaacacaatgattactggttatgttg |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15066646 |
tcttggaacacaatgattactggttatgttg |
15066616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University