View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_51 (Length: 255)
Name: NF11746_high_51
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 18130680 - 18130916
Alignment:
| Q |
1 |
ttatagtctaagtaaccaacctattattattctctgaattcagatgattctgattttgcaagtttatcaaacagataattacattaacaactaccattat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18130680 |
ttatagtctaagtaaccaacctattattattctctgaattcagatgattctgattttgcaagtttatcaaaca-ataattacattaacaactaccattat |
18130778 |
T |
 |
| Q |
101 |
catttttaattgataagttgatacaggtggaaaatggtagttgggaaggtaggtgttggaggttatgataatttactgctggtacatcactatcaagcta |
200 |
Q |
| |
|
|||||||||||||||||||||| ||| ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18130779 |
catttttaattgataagttgatgcagatgggaagtggtagttgggaaggtaggtgttggaggttatgataatttactgctggtacatcactatcaagcta |
18130878 |
T |
 |
| Q |
201 |
aaaaatcaatataaattagtttaagacttttggttgtt |
238 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18130879 |
aacaatcaatataaattagtttaagacttttggttgtt |
18130916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University