View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_52 (Length: 245)
Name: NF11746_high_52
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 154 - 229
Target Start/End: Complemental strand, 29658958 - 29658883
Alignment:
| Q |
154 |
ctttaaggtttgataatttaaagtccacatcaaatattccactcattgagagaacattgttgagtccacacatata |
229 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29658958 |
ctttaaagtttgataatttaaagtccacatcaaatattccactcattgagaaaacattgttgagtccacacatata |
29658883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 4 - 61
Target Start/End: Complemental strand, 29659339 - 29659282
Alignment:
| Q |
4 |
aatagtttgacttattttatattttgttataaagataacttaaacagctgtatgataa |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
29659339 |
aatagtttgacttattttatattttgttataaacaaaaattaaacagctgtatgataa |
29659282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 112 - 157
Target Start/End: Complemental strand, 29659043 - 29658998
Alignment:
| Q |
112 |
ggtataatgtgaaactttgaatgttaatgcagtttctgtgaccttt |
157 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
29659043 |
ggtataatgtgaagctttgaatgttaatgcagtttctatgaccttt |
29658998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University