View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_54 (Length: 241)
Name: NF11746_high_54
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 35288527 - 35288732
Alignment:
| Q |
19 |
attcattgatagagttttttgctctttgttgttatttgtcattttaggtgaatatgctacgagagaggaacacgagttatggcaccatcaagtttgttga |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35288527 |
attcattgatagagtcttttgctctttgttgttatttgtcattttaggtgaatatgctacgagagaggaacacgagttatggcaccatcaagtttgttga |
35288626 |
T |
|
| Q |
119 |
tataggctcagatgattactctcccgacgagaatcagggcctcgactatcaaactgttagtcccttctctatggcctcgaagctgatttatttatttttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35288627 |
tataggctcagatgattactctcccgacgagaatcagggcctcgactatcaaactgttagtcccttctctatggcctcgaagctgatttatttatttttg |
35288726 |
T |
|
| Q |
219 |
gtttca |
224 |
Q |
| |
|
||||| |
|
|
| T |
35288727 |
ctttca |
35288732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University