View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_60 (Length: 238)
Name: NF11746_high_60
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 49755859 - 49755637
Alignment:
| Q |
1 |
ttcaaaattgggattaccaagatgatgaacaacgttctctttccttccagtaaaataattatcaatcacgatcacattatcacctctttcaatcaaacga |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755859 |
ttcaaaattgggattaccaatatgatgaacaacattctctttccttccagtaaaataattatcaatcacgatcacattatcacctctttcaatcaaacga |
49755760 |
T |
 |
| Q |
101 |
tcaacaagatgacttccaacgaaaccagctccaccggtaaccagtactctcttctgtctcttgcttttcaatccaacggccaatggaactcttcgttttc |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755759 |
tccacaagatgacttccaacgaaaccagctccaccggtaaccagtactctcttctgtctcttgcttttcaatccaacggccaatggaactcttcgttttc |
49755660 |
T |
 |
| Q |
201 |
tttcatctctaccgtgttcctct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49755659 |
tttcatctctaccgtgttcctct |
49755637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 143
Target Start/End: Complemental strand, 29127054 - 29126946
Alignment:
| Q |
35 |
ttctctttccttccagtaaaataattatcaatcacgatcacattatcacctctttcaatcaaacgatcaacaagatgacttccaacgaaaccagctccac |
134 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| || || |||| || ||||| ||||||| |||||| |||||||||||||| |||||||| |||| |
|
|
| T |
29127054 |
ttctctttcctaccagtaaaaaaattatcaataacaataacatcattccctctaccaatcaacttatcaaccagatgacttccaacaaaaccagcaccac |
29126955 |
T |
 |
| Q |
135 |
cggtaacca |
143 |
Q |
| |
|
||||||||| |
|
|
| T |
29126954 |
cggtaacca |
29126946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University