View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_64 (Length: 211)
Name: NF11746_high_64
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_64 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 12 - 186
Target Start/End: Complemental strand, 803515 - 803349
Alignment:
| Q |
12 |
gagcagagaccttaatccgaggacacttatttgaatagacacaatatataaactgaaattaattttagatatcccactctccaattgagaattaatctca |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
803515 |
gagcagacaccttaatccgaggacacttatttgaatggacacaata----aactgaaattaattttagatatcccactctccaattgag----aatctca |
803424 |
T |
 |
| Q |
112 |
gttcctaatgacgtagtagatctctcatatgnnnnnnnaacttgactttgtcaaatggtaaagactttgctatgc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
803423 |
gttcctaatgacgtagtagatctctcatatgtttttttaacttgactttgtcaaatggtaaagactatgctatgc |
803349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University