View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_high_65 (Length: 211)
Name: NF11746_high_65
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_high_65 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 36231772 - 36231953
Alignment:
| Q |
14 |
gaagcataggtaatgatgttgaaggtggaagagtagcaattgatacatcctctgaagaaggaagcatattagcttccatgagtttgtatttatgtatttc |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36231772 |
gaagcattggtaatgatgttgaaggtggaagagtagcaattgatacatcctctgaagaaggaagcatattagcttccatgagtttgtatttatgtatttc |
36231871 |
T |
|
| Q |
114 |
ttcccttatagcattaagttcacctattaatgattgaacttgttgttgcaaagatgaaattgcacccatgcatccataaact |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36231872 |
ttcccttatagcattaagttcacctattaatgattgaacttgttgttgcaaagatgaaattgcacccatgcatccataaact |
36231953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 194
Target Start/End: Original strand, 31868948 - 31868997
Alignment:
| Q |
145 |
gattgaacttgttgttgcaaagatgaaattgcacccatgcatccataaac |
194 |
Q |
| |
|
||||| ||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
31868948 |
gattggacttgttgttgtaatgatgatattgcacccatgcatccataaac |
31868997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 145 - 195
Target Start/End: Original strand, 43200646 - 43200696
Alignment:
| Q |
145 |
gattgaacttgttgttgcaaagatgaaattgcacccatgcatccataaact |
195 |
Q |
| |
|
|||||||| ||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
43200646 |
gattgaacctgttgttgcaatgcagaaattgcacccatgcatccataaact |
43200696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University