View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_low_24 (Length: 379)
Name: NF11746_low_24
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 17 - 369
Target Start/End: Complemental strand, 45740033 - 45739681
Alignment:
| Q |
17 |
atatatgaagtaaaattcctaatgcacctagattcatggcccataaactttataatgcaccctacgtactaatgatacccccctagttagaaaacagttc |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
45740033 |
atatatgaagtaaaattcctgatgcacctagattcatggcccataaactttataatgcaccctacggactaatgatacccccctagttggaaaacagttc |
45739934 |
T |
 |
| Q |
117 |
tatccaaaaggtgtttggtcaattttttaaattttgcatcgtagatgttatggtctagtcaaacatacactctagatctgaccgttataagcgtggttac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45739933 |
tatccaaaaggtgtttggtcaattttttaaattttgcatcgtagatgttatggtctagtcaaacatacactctagatctgaccgttataagcgtggttac |
45739834 |
T |
 |
| Q |
217 |
attgttcagcgaccgtagattcataaccgtattccatacctgtgtatgaaagttgctttgtaagtctcttgcattgatcaaaagtttcttggattgatcg |
316 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45739833 |
attgttcagcggccgtagattcataaccgtattccatacctgtgtatgaaagttgctttataagtctcttgcattgatcaaaagtttcttggattgatcg |
45739734 |
T |
 |
| Q |
317 |
gatcataacttctgatgacacaaaatctatcgtttgttacgacccgacctttg |
369 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45739733 |
gatcataacttctgacgacacaaaatctatcgttggttacgacccgacctttg |
45739681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University