View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_low_28 (Length: 354)
Name: NF11746_low_28
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 10 - 339
Target Start/End: Complemental strand, 30757096 - 30756768
Alignment:
| Q |
10 |
agaagaaaaataatcgcgaagcatatccaaccccgctcaaagggttcacgttcaccatcatctattcgccaatgatattacgggaatatgcaactgttac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30757096 |
agaagaaaaataatcgcgaagcatatccaaccccgctcaaagggttcacgttcaccatcatctattcgccaatgatattacgggaatatgcaactgtttc |
30756997 |
T |
 |
| Q |
110 |
ctattaggagagactttttcagggccgctacggtttgcctaattactgtttccttactacttcnnnnnnnnnnnnnnnnnncttattcttttcgcatatc |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30756996 |
ctattaggagagactttttcagggctgctacggtttgcctaattactgtttccttactacttc-tttttctttgtttttttcttattcttttcgcatatc |
30756898 |
T |
 |
| Q |
210 |
ttggagtttttgcatggcaacatctctttttattacatacactctcaatcaagtaattgaaaattgataatggtaaataatgtcttaatgcctattattt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30756897 |
ttggagtttttgcatggcaacatctctttttattacgtacactctcaatcaagtaattgaaaattgataatggtaaataatgtcttaatgcctattattt |
30756798 |
T |
 |
| Q |
310 |
gagaaccattaaggtttgacaactcaaatt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30756797 |
gagaaccattaaggtttgacaactcaaatt |
30756768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University