View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11746_low_33 (Length: 333)
Name: NF11746_low_33
Description: NF11746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11746_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 238 - 325
Target Start/End: Complemental strand, 15966489 - 15966402
Alignment:
| Q |
238 |
tgaccatgaagtgtttatagtaaatgcattgcaatggtaacataccttaaatgcatttgtgaagtgtccctttttcaatcttcatctc |
325 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15966489 |
tgaccatgaagtggttttagtaaatgcattgcaatggtaacataccttaaatgcatttgtgaagtggccctttttcaatcttcatctc |
15966402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 15966586 - 15966554
Alignment:
| Q |
1 |
ggacatggaatgatctcttcttgtgacgtacac |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
15966586 |
ggacatggaatgatctcttcttgtgacgtacac |
15966554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 212 - 240
Target Start/End: Complemental strand, 15966542 - 15966514
Alignment:
| Q |
212 |
atttctacatgcctatccttgcagtgtga |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15966542 |
atttctacatgcctatccttgcagtgtga |
15966514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University