View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11747_high_18 (Length: 323)
Name: NF11747_high_18
Description: NF11747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11747_high_18 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 48 - 323
Target Start/End: Original strand, 55892908 - 55893180
Alignment:
| Q |
48 |
aataattattttttcaatgatgcttttgttgatactctgggccaaaccgagtgagaaacatcatcgtcttttgaccatttccctgttgtcataatgtttt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55892908 |
aataattattttttcaatgatgcttttgttgatactctgggccaaaccgagtgagaaacatcatcgtcttttgaccatttccgtgttgtcataatgtttt |
55893007 |
T |
 |
| Q |
148 |
gtagtgtcatgaataaccttaatcattttctaattctcttgctatcttactcaccaaatcattagtttaatttagtccnnnnnnncttccaagaatgaca |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
55893008 |
gtagtgtcatgaataaccttaatcattttctaattctcttgctatcttactcaccaaatcattagtttaatttagtcctttttttcttccaagaatgaca |
55893107 |
T |
 |
| Q |
248 |
catggtaatatggtataataatgcaacttgatttagaataattccattcacatatggcctattgagccggctacca |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
55893108 |
catggtaatatggtataataatgcaacttgatttagaataattccattcacatacggccta---agccggctacca |
55893180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 13 - 50
Target Start/End: Original strand, 55891677 - 55891714
Alignment:
| Q |
13 |
atttatactattccatatgccgcttttaactcttaaat |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
55891677 |
atttatactattccatatgccgcttttaacttttaaat |
55891714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University