View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11747_high_21 (Length: 316)
Name: NF11747_high_21
Description: NF11747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11747_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 175 - 309
Target Start/End: Complemental strand, 5041996 - 5041861
Alignment:
| Q |
175 |
atgttccatcacttcca-cataaaagcctattatttttaccaatatattgcttcttcctactttctatagtgtcattcagtttgtgctattttgcttcat |
273 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5041996 |
atgttccatcacttccaacataaaagcctattttttttaccaatatattgcttcttcctactttctatagtgtcattcagtttgtgctattttgcttcat |
5041897 |
T |
 |
| Q |
274 |
cttttacaatcagtcccttcacttctctgcttctcc |
309 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| |
|
|
| T |
5041896 |
cttttacaatcagtcccttcacttctcagattctcc |
5041861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 48 - 114
Target Start/End: Complemental strand, 5042123 - 5042057
Alignment:
| Q |
48 |
tttgtacatataatatatagttttggattattgtttggatagaggctcgtcaaccaaaggagaggta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042123 |
tttgtacatataatatatagttttggattattgtttggatagaggctcgtcaaccaaaggagaggta |
5042057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University