View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11747_high_32 (Length: 239)
Name: NF11747_high_32
Description: NF11747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11747_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 30242325 - 30242121
Alignment:
| Q |
18 |
ttatccagctctcatgatattcatctttatcgtattattatgtccactaaacataccatgataatctttgtttgacaatttcccattgaaaataacttgt |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30242325 |
ttatccaactctcatgatattcatctttatcgtattattatgtccactaaacataccatgataatctttgtttgacaatttcccattaaaaataacttgt |
30242226 |
T |
 |
| Q |
118 |
tgattgtttcagattggatggaaaactttatatttttgttgtaaacatgaagggaatgattttgttgttgtgcaatgccttttcaatctaagcttttggc |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30242225 |
tgattgtttcagattggatggaaaacattatatttttgttgtaaacatgaagggaatgattttgttgttgtgcaatgccttttcaatctaagcttttggc |
30242126 |
T |
 |
| Q |
218 |
cggtc |
222 |
Q |
| |
|
||||| |
|
|
| T |
30242125 |
cggtc |
30242121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University