View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11747_low_28 (Length: 284)
Name: NF11747_low_28
Description: NF11747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11747_low_28 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 329508 - 329781
Alignment:
| Q |
1 |
ccgagccgaagtttcgaacctgattaacgaactagcatcagattcgaaacctggatcagaaatcctatccttattttggattaaaaaatgtcttggaatc |
100 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329508 |
ccgagccgaagtttcgaatctggttaacgaattagcatcagattcgaaacctggatcggaaatcctatccttattttggattaaaaaatgtcttggaatc |
329607 |
T |
 |
| Q |
101 |
ttacccttgatcaacaaggcatttacaaagtttactttggagatagattatccaatgagtaaatgggaggttgattccattgaagagtatctgaactaca |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
329608 |
ttacccttgatcaacaaggcttttacaaagtttactttggagatagattatccaatgagtaaatgggaggttgattccattgaagagtatctcaactaca |
329707 |
T |
 |
| Q |
201 |
gtttgtgtttgttagagcttttcaattcaatttcttcttctctttctcatcttgaaaaagctaagctttctctg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329708 |
gtttgtgtttgttagagcttttcaattcaatttcttcttctctttctcatcttgaaaaagctaagctttctctg |
329781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 146 - 254
Target Start/End: Complemental strand, 8869990 - 8869882
Alignment:
| Q |
146 |
gattatccaatgagtaaatgggaggttgattccattgaagagtatctgaactacagtttgtgtttgttagagcttttcaattcaatttcttcttctcttt |
245 |
Q |
| |
|
||||||||||||| ||||||| | |||||||| ||||||| ||||| ||||| | || ||||||| |||||| | ||||| |||||||||||||||| |
|
|
| T |
8869990 |
gattatccaatgactaaatggaacgttgattcaattgaagtttatctcaactataccatgagtttgttggagcttctgaattccatttcttcttctcttt |
8869891 |
T |
 |
| Q |
246 |
ctcatcttg |
254 |
Q |
| |
|
||||||||| |
|
|
| T |
8869890 |
ctcatcttg |
8869882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 146 - 254
Target Start/End: Original strand, 11141799 - 11141907
Alignment:
| Q |
146 |
gattatccaatgagtaaatgggaggttgattccattgaagagtatctgaactacagtttgtgtttgttagagcttttcaattcaatttcttcttctcttt |
245 |
Q |
| |
|
||||||||||||| ||||||| | |||||||| ||||||| ||||| ||||| | || ||||||| ||| || | |||| |||||||||||||||| |
|
|
| T |
11141799 |
gattatccaatgactaaatggaacgttgattcaattgaagtttatctcaactataccatgagtttgttggaggttctgaatttcatttcttcttctcttt |
11141898 |
T |
 |
| Q |
246 |
ctcatcttg |
254 |
Q |
| |
|
||||||||| |
|
|
| T |
11141899 |
ctcatcttg |
11141907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University