View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11747_low_36 (Length: 237)
Name: NF11747_low_36
Description: NF11747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11747_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 36327506 - 36327751
Alignment:
| Q |
1 |
cacttgacttatatcccacatttctctattcattgccgcccgcatttccactggatcctcccatatttccacgtccacccccc------------ggaaa |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
36327506 |
cacttgacttatatcccacatttctctattcattgccgcccgcatttccactggatcctcccaaatttccacgtccacccccttttccaccgcctggaaa |
36327605 |
T |
 |
| Q |
89 |
gtgaacgacgtttcctccgccacctttgtgtccaacagcaggagagtttaccgcatttcccatgacgggaaagtgtacgatgtttccattgtcctcctct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36327606 |
gtgaacgacgtttcctccgccacctttgtgtccaacagcaggagagtttaccgcatttcccatgacgggaaagtgtacgatgtttccattgtcctcctct |
36327705 |
T |
 |
| Q |
189 |
ttttgactgtcaagaaagtttatgacatttccaccaacacactcgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36327706 |
ttttgactgtcaagaaagtttatgacatttccaccaacacactcgt |
36327751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University