View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11748_high_5 (Length: 354)
Name: NF11748_high_5
Description: NF11748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11748_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 19 - 316
Target Start/End: Complemental strand, 47990807 - 47990512
Alignment:
| Q |
19 |
acccagctcaatgagtagactgaacaaggaggggcgttatcaactggnnnnnnnntcacaaattgaaggtaaacctaacattaatagtaaaattcgtgag |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47990807 |
acccagctcaatgagtagactgaacagggaggggcgttatcaactg--aaaaaaatcacaaattgaaggtaaacctaacattaatagtaaaattcgtgag |
47990710 |
T |
|
| Q |
119 |
atattagataagagcgcatgcctttgaaggaggaagaatttcagagtagaatcgagggagcccaccacgagactgatctccataatcggaattgaatgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47990709 |
atattagataagagcgcatgcctttgaaggaggaagaatttcagagtagaatcgagggagcccaccacgagactgatctccataatcggaattgaatgaa |
47990610 |
T |
|
| Q |
219 |
cgaattctgctcaagcttcgacggagagatattcgatttgcgaagcgaaaccttgcgggaactactagggtttgcaacatttgtaccaattcaatttc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47990609 |
cgaattctgctcaagcttcgacggagagatattcgatttgcgaagcgaaaccttgcgggaactactagggtttgcaacatttgtaccaattcaatttc |
47990512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University