View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11748_high_6 (Length: 315)
Name: NF11748_high_6
Description: NF11748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11748_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 19 - 304
Target Start/End: Original strand, 6705785 - 6706070
Alignment:
| Q |
19 |
gtactagatgttgatgttgttgttgatgaccataggttggaccacttggcattgacatagatatggacaaggacgaagaagatgaggaagatgtcgtttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6705785 |
gtactagatgttgatgttgttgttgatgaccataggttggaccacttggcattgacatagatatggacaaggacgaagaagatgaggaagatgtcgtttg |
6705884 |
T |
 |
| Q |
119 |
ttcgaaaaacaaagaagaattaaaatttgagcaacctctggtcgatggttgctccaaattgggccgcgaagcagcccaatttgttggtaacaactcaagc |
218 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6705885 |
ttcaaaaaacaaagaagaattaaaatttgagcaacctctggtcgatggttgctccaaattgggccgcgaagcagcccaatttgttggtaacaactcaagc |
6705984 |
T |
 |
| Q |
219 |
tccaacaagcctgaactgcttgttggagtctggttatgatcacgaccatgtttcgtggttgtggtcacggccgtattacctatgct |
304 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6705985 |
tccagcaagcctgaactgcttgttggagtctggttatgatcacgaccatgtttcgtggttgtggtcacggccgtattacctatgct |
6706070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University