View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11748_high_7 (Length: 249)
Name: NF11748_high_7
Description: NF11748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11748_high_7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 8391280 - 8391047
Alignment:
| Q |
16 |
agaaataaaagattttcttagaacaaaacgtggagaaggtatcgatgttcgcctggcgtttgtttcgccatagattgccttctaaaatgaatttgttccg |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8391280 |
agaaataaaacattttcttagaacaaaacgtggagaaggtatcgatgttcgcctggcgtttgtttcgccatagattgccttctaaaatgaatttgttccg |
8391181 |
T |
|
| Q |
116 |
tagaggcgtcattcttccatatgaccaatattgtgttagtggttgcggttatcatgaatttgagagtcacttatttttgtcttgtgannnnnnnggacaa |
215 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
8391180 |
tagaggcgtcattcttccagatgatcaatattgtgttagtggttgcggttatcatgaatttgagagtcacatatttctgtcttgtgattttttcggacaa |
8391081 |
T |
|
| Q |
216 |
ctttggcaacttgtaaggaactggctcggtgttc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
8391080 |
ctttggcaacttgtaaggaactggctcgatgttc |
8391047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 69 - 122
Target Start/End: Complemental strand, 38734108 - 38734055
Alignment:
| Q |
69 |
tggcgtttgtttcgccatagattgccttctaaaatgaatttgttccgtagaggc |
122 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||| || ||||||||||||||| |
|
|
| T |
38734108 |
tggcgcttgtttcgcaatagattgccttctaaatcaaacttgttccgtagaggc |
38734055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University