View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11749_high_7 (Length: 258)
Name: NF11749_high_7
Description: NF11749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11749_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 11062455 - 11062206
Alignment:
| Q |
1 |
ttggatgctacaagggaatatgcggatgagtggagcca-taaaggattacttgtggctcaagttatgagactcctctattaatcaaatagtacattctca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11062455 |
ttggatgctacaagggaatatgcggatgagtggagccactaaaggattacttgtggctcaagttatgagactcctctattaatcaaatagtacattctca |
11062356 |
T |
|
| Q |
100 |
aaagataaggaatattcttatgcttaatataaggatgagtggggccactgaaggattactttgtagctcaaccctgattccataaccttaggagtagtta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11062355 |
aaagataaggaatattcttatgcttaatataaggatgagtggggccactgaaggattactttgtagctcaaccctgattccataaccttaggagtagtta |
11062256 |
T |
|
| Q |
200 |
ctaagtgagtagttctcatgcaaaaaactcattgttgtaatcttcatctc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11062255 |
ctaagtgagtagttctcatgcaaaaaactcattgttgtaatcttcttctc |
11062206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University