View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11749_low_10 (Length: 260)
Name: NF11749_low_10
Description: NF11749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11749_low_10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 125 - 260
Target Start/End: Original strand, 13711422 - 13711557
Alignment:
| Q |
125 |
tgagaggatgaatgatcattctggaagcctgagcgggtaaattaactagaaaacccttttgcttcttgtttttcttggacaccacctcaaagaaagactc |
224 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13711422 |
tgagaggacgaatgctcattctggaagcctgagcgggtaaattaactagaaaacccttttgcttcttgtttttcttggacaccacctcaaagaaaggctc |
13711521 |
T |
|
| Q |
225 |
ttcaataacaatagaacgattctttaaataatttat |
260 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13711522 |
ttcaataacaacagaacgattctttaaataatttat |
13711557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 185 - 260
Target Start/End: Complemental strand, 21514959 - 21514884
Alignment:
| Q |
185 |
gcttcttgtttttcttggacaccacctcaaagaaagactcttcaataacaatagaacgattctttaaataatttat |
260 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||| |||||| ||| || ||||| |||||||||||||||||| |
|
|
| T |
21514959 |
gcttcttgtttttcttggagactacctcaatgaaaggctcttccatagcagcagaacaattctttaaataatttat |
21514884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 260
Target Start/End: Complemental strand, 8673681 - 8673585
Alignment:
| Q |
163 |
aaattaactagaaaacccttttgcttcttgtttttcttggacaccacctcaaagaaagactcttcaataacaatagaacgattctttaaataatttat |
260 |
Q |
| |
|
|||| ||| |||||||||||| |||||||| |||| |||| ||| ||||||| ||||| ||||| |||| | |||||||||||||||||| ||||| |
|
|
| T |
8673681 |
aaatgaaccagaaaaccctttagcttcttgcttttattgg-cactacctcaatgaaaggttcttccataatagcagaacgattctttaaatactttat |
8673585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University