View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11749_low_13 (Length: 245)
Name: NF11749_low_13
Description: NF11749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11749_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 14 - 227
Target Start/End: Original strand, 41065830 - 41066043
Alignment:
| Q |
14 |
agacagtgtttgtggatcttgaccgaaagccaagccacatatgttgtcgaaagtgaggcgtaggagaaggtcttgaagatcaaccgggnnnnnnncttct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41065830 |
agacagtgtttgtggatcttgaccgaaagccaagccacatatgttgtcgaaagtgaggcgtaggagaaggtcttgaagatcaaccgggtttttttcttct |
41065929 |
T |
|
| Q |
114 |
tgtgccgtcgctaatattggacagaatctatactttatggctcggctaacccatcgagccatggcttgtcgtagggtacgagtggtggactctagtgcgg |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
41065930 |
tgtgccgtcgctaaaattggacagaatctatactttatggctcggctaacccatcgagccatggcttgtcgtagggtacgagtggtgaactctagtgctg |
41066029 |
T |
|
| Q |
214 |
cggttttacgctgg |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41066030 |
cggttttacgctgg |
41066043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 223
Target Start/End: Complemental strand, 25243363 - 25243287
Alignment:
| Q |
147 |
tttatggctcggctaacccatcgagccatggcttgtcgtagggtacgagtggtggactctagtgcggcggttttacg |
223 |
Q |
| |
|
||||||| |||| | ||||| |||||||||||||| || ||||| ||||| ||| | || ||||| ||||||||||| |
|
|
| T |
25243363 |
tttatggttcggttcacccaacgagccatggcttgacgaagggttcgagttgtgaattcgagtgcagcggttttacg |
25243287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University