View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11749_low_13 (Length: 245)

Name: NF11749_low_13
Description: NF11749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11749_low_13
NF11749_low_13
[»] chr8 (1 HSPs)
chr8 (14-227)||(41065830-41066043)
[»] chr3 (1 HSPs)
chr3 (147-223)||(25243287-25243363)


Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 14 - 227
Target Start/End: Original strand, 41065830 - 41066043
Alignment:
14 agacagtgtttgtggatcttgaccgaaagccaagccacatatgttgtcgaaagtgaggcgtaggagaaggtcttgaagatcaaccgggnnnnnnncttct 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||    
41065830 agacagtgtttgtggatcttgaccgaaagccaagccacatatgttgtcgaaagtgaggcgtaggagaaggtcttgaagatcaaccgggtttttttcttct 41065929  T
114 tgtgccgtcgctaatattggacagaatctatactttatggctcggctaacccatcgagccatggcttgtcgtagggtacgagtggtggactctagtgcgg 213  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |    
41065930 tgtgccgtcgctaaaattggacagaatctatactttatggctcggctaacccatcgagccatggcttgtcgtagggtacgagtggtgaactctagtgctg 41066029  T
214 cggttttacgctgg 227  Q
    ||||||||||||||    
41066030 cggttttacgctgg 41066043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 223
Target Start/End: Complemental strand, 25243363 - 25243287
Alignment:
147 tttatggctcggctaacccatcgagccatggcttgtcgtagggtacgagtggtggactctagtgcggcggttttacg 223  Q
    ||||||| |||| | ||||| |||||||||||||| || ||||| ||||| ||| | || ||||| |||||||||||    
25243363 tttatggttcggttcacccaacgagccatggcttgacgaagggttcgagttgtgaattcgagtgcagcggttttacg 25243287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University