View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11749_low_17 (Length: 222)
Name: NF11749_low_17
Description: NF11749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11749_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 14 - 169
Target Start/End: Original strand, 38238054 - 38238209
Alignment:
| Q |
14 |
cacagaggtagctactgacactgatattctcaccggacgtgctatcaatgctgcaattgttctcggatttggagcttttgctgtcaccaaattgctcacc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38238054 |
cacagaggtagctactgacactgatattctcaccggacgtgctatcaatgctgcaattgttctcggatttggagcttttgctgtcaccaaattgctcacc |
38238153 |
T |
 |
| Q |
114 |
attgatcatgattactggcatgttagtttcttctagtttatattaaaatttgcttc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38238154 |
attgatcatgattactggcatgttagtttcttctggtttatattaaaatttgcttc |
38238209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University